sábado, marzo 19, 2011

Amanece en Miami

Emepezamos nuestro primer día en Miami. Amanece a las 5 de la mañana para algunos (Mari y yo) y a las 7 ya estábamos todos levantados. Ahora tenemos el jetlag de la llegada, que nos levantamos como si fuera nuestro medio día, te levantas muy despierto y con hambre.

Lo bonito de levantarte tan temprano es poder ver la ciudad desde un punto de vista que no es el habitual, sin coches y con una luz diferente. Y queda demostrado que esta ciudad que nos acoge, es bonita de todas las maneras.



Recomendaciones para viajar a Miami, te sugiero a la llegada: Alquilar coche en Aeropuerto de Miami (alquilerdecochesmania.com) o alquilar coche en Miami (Buscar) o alquilar coche en Miami Beach (Buscar), depende de donde vayas y puedes buscar en varias decenas de oficinas por toda la ciudad. Para llegar Vuelos baratos a Miami : flightsmania.com y para alojarse: Hoteles baratos en Miami (-- y lo pagas al llegar al hotel). Guía de MiamiMiamisecreto.com.

Javi activando el robot de limpieza para que se quede limpiando la moqueta de la casa cuando nos vayamos hoy de compras.

Y lo que te digo, todos corriendo al Blog para ver que comentarios nos has dejado y hablar con la familia para contarles como nos lo estamos pasando. Yo tengo la ventaja de tener el Blog para contártelo.


Hasta Javi.... que lo primero que me ha preguntado esta mañana es "¿Has publicado otra entrada del Blog?"

Y muy muy bonita es la salida del sol en el mar vista desde casa.


Como poco a poco cada vez va habiendo más luz en el mar...

Hasta que finalmente se hace el día.

Y la tradición manda que hay que empezar el día en Dennys, además esta vez en un Dennys nuevo al norte de Miami, camino de la zona de compras.

Que buena imagen llegar y encontrarte las tartas recien hechas, tan de película o serie de televisión.
Los Alejandros y yo hemos llegado con mucha hambre, es lo que pasa cuando para tu cuerpo es medio día y no has desayunado, que las tostadas, zumo y café para ti, que yo lo que quiero es un filete de ternera empanado, con salchichas, bacon y huevos revueltos con patatas y queso.

Patricia y Javi se han pedido un sandwich de huevos revueltos con jamón y queso. Este primer día el desayuno siempre lo hacemos fuerte para ir haciendo el cuerpo a la nueva hora, el resto de los días serán desayunos más normales.


Y Mari se ha pedido unas bolitas hechas con la misma masa de las tortitas, rellenas de arándanos y chocolate blanco que estaban muy buenas.


Patricia es lo mismo de Javi, pero en vez de en pan, en tortilla.

Hoy es un día que necesitamos buena comida, porque es el día de las compras y hoy se gasta mucho en todos los sentidos...




13 comentarios:

  1. Marymarisol6:13 a. m.

    Quiero felicitar a Antonio, a todos los Jose, Maria Jose, Josefina, etc, muchas felicidades que paseis buen dia.
    Mari muchas gracias por las gafas, como puedes ver ya las he usado.
    Lore wapa las patatas tan de muerte guapina, con un queso que está que te mueres.
    Muchisimas gracias a toda la gente que escribis en el blog, no veaís la ilusión que nos hace y como corremos para leer los comentarios que nos poneis.
    Un besazo enorme para todos, pero los más grandes para Jairín, Amara y por supuesto para mi niño grande, muasssssssssssssss ciao.

    ResponderEliminar
  2. Muchas Felicidades papá!!!
    Espero que lo paseis muy bien y dile al descastao de mi hijo que a ver si me dice él algo ;-)

    Un besazo!

    DVD

    ResponderEliminar
  3. Me uno a las felicitaciones!!!!

    Y viendo las fotos, cierro los ojos y ya huelo a mar...mmmmm...me encanta!!!

    Besos a todos!

    ResponderEliminar
  4. Guuuuaaaauuuu.
    guuuuuuuuuuaaaaaaaauuu
    guuaauu.guuuaaauuu

    ResponderEliminar
  5. Aquí también ha amanecido con un sol radiante. No puedo felicitar a mi padre.... pero sí¨a varíos JOSÉS que me tienen quitado el "sentió" . Mi Amador en realidad se llama José, así que ese el primen. El segundo mi nuevo sobrino, que acaba de cumplir 3 meses y es una ricura. Además voy a ser su madrina!!! y eso es lo que hay... Después Jose mi gran vechino, que él sabe que lo queremos mucho!!!

    En general, besos a todos los Joses, Pepas, Maria Josés y de todo.

    ResponderEliminar
  6. Anónimo10:01 a. m.

    Bueno ,en vista que os gusta que os pongan comentarios os pondre algo.
    muy muy bonitas las fotos que has puesto, son de las que te dan tranquilidad nada mas que con mirarlas y como se nota vuestro trabajo por eso cada uno tiene su ordeador. Espero que hayais comprado muchas cosas y que pongas las fotos con las bolsas que no digan que nosotros somos las que mas gastamos
    Un beso para todos y seguid pasandolo bien. Victoria

    ResponderEliminar
  7. Mari Carmen10:14 a. m.

    Hola ¿que tal las compras?
    Mari, Cesar ya esta aqui ya a estado lellendo el blog y se a ido a casa de Jose Manuel.
    Las gafas te quedan muy bien.
    Muchos besos.

    ResponderEliminar
  8. Hola, soy Fernando, el padre de Álex.
    Ayer cada vez que miraba la hora pensaba.. "ahora estarán haciendo...", .."ahora estarán en...". Y aquí estamos, su madre y yo siguendo el viaje día a día.
    Se palpa en el ambiente que lo estais disfrutando TODOS.
    Nosotros también.
    Un beso para todos.

    ResponderEliminar
  9. HOLA A TODOS,GRACIAS POR LAS FELICITACIONES.QUE LO PASEIS
    MUY BIEN,UN ABRAZO

    ResponderEliminar
  10. Lorena Bega12:45 p. m.

    Buenos dias a todos! (es buenos dias no) jejejejej k hora es alli? yo me lio mucho eh!!
    Que maravilla ver el amanecer, es una pasada, y ya el desayuno!! sin comentarios!! Mariiii!! si mis pies tocan ese suelo alguna vez ,me pedire las bolas eh!que pinta tiene!!!k ricas!! Bueno que tengais un pedazo de día y que compreis mucho mucho!!!
    Un beso pa tos y un achuchon a mi cuña!! seguid disfrutando!!
    besos cariño,disfruta!!!

    ResponderEliminar
  11. Antes que nada felicitar a todos los Joses, Marijoses, pepes, pepas, josefinas que haya en el blog
    Además a todos los padres y a los que vayan a ser padres dentro de poco

    ResponderEliminar
  12. ¡Hola!

    Gracias a todos por vuestros comentarios y por seguir nuestra aventura por esta preciosa ciudad, que nos está encantando a todos, y eso que aún no hemos visto nada como quien dice...

    ¡Saludos a todos!

    ResponderEliminar
  13. Hoy me estoy poniendo al día del viaje... y otra vez estais en mi Denny´s!!!! No es justo!!! Que estoy embarazada y tengo antojos de ver estas entradas...un poquito de compasión!!!!!jejejeje....
    Yo no tendría duda con midesyauno: huevos revueltos con salchichas, bacon y un par de tortitas!!!! Con mi zumito de naranja, por supuesto...
    Bueno, me voy a comer que así no puedo másss

    Besotessss

    ResponderEliminar